Rockville, MD
Collaborative
We are a bioinformatics team within the Center for Biomedical Informatics and Information Technology’s (CBIIT’s) Cancer Informatics Branch (CIB)—soon to be referred to as the Informatics and Data Science (IDS) Program. Headed Read More...
Web Page
What is Xenium? Xenium is a high-resolution, imaging-based in situ spatial profiling technology from 10x Genomics that allows for simultaneous expression analysis of RNA targets (currently in range of 100’s) within the same tissue section. Read More...
Frederick, MD
Core Facility
Molecular Cytogenetics Core Facility facilitates the assessment of structural and numerical genomic changes in pre-cancer and cancer research models. This core provides comprehensive support for the cytogenetic analysis of cells from human and research animal Read More...
Web Page
Bioinformatics
02/08/2021 - Dear colleagues, Coming Monday, Feb 8th, we'll be having a guest lecture by Prof. Vineet Bafna from UCSD. Abstract: Increase in the number of copies of tumor promoting (onco-) genes is a hallmark Read More...
Web Page
Bioinformatics
06/09/2021 - The CCR Office of Science and Technology Resources (OSTR) is pleased to host a virtual technology seminar given by Advanced Cell Diagnostics (ACD) and NCI Cores at FNLCR. Presenters: Jyoti Phatak, MS | Advanced Cell Read More...
Web Page
Bioinformatics
To delete a file use the rm command followed by the file name. For instance, to delete bioinformatics_for_noobies.txt do: rm bioinformatics_for_noobies.txt Warning There is no trash can or recycling Read More...
Web Page
Bioinformatics
To delete a file use the rm command followed by the file name. For instance, to delete bioinformatics_for_noobies.txt do: rm bioinformatics_for_noobies.txt Warning There is no trash can or recycling Read More...
Web Page
Bioinformatics
The plot below shows the sequence duplication levels. High levels of duplication may indicate an enrichment bias such as over-amplification in the PCR step. However, in RNA sequencing, duplicate sequences could be biologically meaningful as Read More...
Web Page
Bioinformatics
02/12/2013 - This lecture will provide an overview of Illumina sequencing technology as implemented at the CCR Sequencing Facility (SF). It will outline the data and sample QC and analysis workflow performed by the facility and Read More...
Web Page
Bioinformatics
To delete a folder, use the rm command with the -r options, which enables deletion of the folder and everything that is in it. To delete the lesson2_january_2024_unix_class directory, use the following. Read More...
Web Page
Bioinformatics
An OTU is an operational taxonomic unit. This is derived by binning sequences at a certain threshold of similarity. This threshold is generally set at 97%, which is associated with a species level assignment. Clustering can Read More...
Web Page
Bioinformatics
sed stands for stream editor. Functions include searching, find and replace, and insertion / deletion. sed is often used for its "find and replace" capabilities. For example, let's replace "SRR" in Read More...
Web Page
Bioinformatics
Genomic variations are typically categorized into different classes and are often denoted with a shortened acronym: SNP, a single nucleotide polymorphism - A change of a single base. INDEL, an insertion or a deletion - Read More...
Web Page
Bioinformatics
10/21/2022 - Single cell chromatin accessibility, measured by ATAC-seq, and single cell gene expression, measured by RNA-seq provide two views on a cell’s state. From chromatin accessibility it is possible to infer information about the Read More...
Web Page
Bioinformatics
03/31/2021 - Link to recording: https://web.microsoftstream.com/video/78e8e458-f5c7-4aa4-b5ea-9cd94b20452a Helen Shearman, PhD, Senior Field Application Scientist, will be presenting a one-hour overview demonstration on Read More...
Web Page
Bioinformatics
02/15/2017 - nSolver™ Analysis Software is a free analysis platform for storage, custom QC, and custom normalization of nCounter data. Generate highly-customized exports, basic statistical outputs, and publication-quality figures quickly and easily with the included tools. Read More...
Web Page
Bioinformatics
Long read sequencing was recently named 2022’s method of the year by Nature Methods . Long read sequencing technologies, those that generate sequence reads with lengths of 10s of kilobases or longer have several advantages over Read More...
Web Page
Bioinformatics
This page uses content directly from the Biostar Handbook by Istvan Albert. Learn: FASTQC for assaying quality of sequence reads MultiQC for combining multiple FASTQC reports into one report Trimmomatic for removing sequence data based Read More...
Web Page
Bioinformatics
This page uses content directly from the Biostar Handbook by Istvan Albert. Learn: FASTQC for assaying quality of sequence reads MultiQC for combining multiple FASTQC reports into one report Trimmomatic for removing sequence data based Read More...
Web Page
Bioinformatics
Change in the ~/biostar_class/hbr_uhr/hbr_uhr_hisat2 folder for this portion of the class. cd ~/biostar_class/hbr_uhr/hbr_uhr_hisat2 Now that we have our SAM files generated for the Read More...
Web Page
Bioinformatics
Change in the ~/biostar_class/hbr_uhr/hbr_uhr_hisat2 folder for this portion of the class. cd ~/biostar_class/hbr_uhr/hbr_uhr_hisat2 Now that we have our SAM files generated for the Read More...
Web Page
Bioinformatics
Retrieve R "helper" scripts developed for Biostars environment. curl -O http://data.biostarhandbook.com/rnaseq/code/deseq1.r curl -O http://data.biostarhandbook.com/rnaseq/code/deseq2.r curl -O http://data.biostarhandbook. Read More...
Web Page
Bioinformatics
Retrieve R "helper" scripts developed for Biostars environment. curl -O http://data.biostarhandbook.com/rnaseq/code/deseq1.r curl -O http://data.biostarhandbook.com/rnaseq/code/deseq2.r curl -O http://data.biostarhandbook. Read More...
Web Page
Bioinformatics
Retrieve R "helper" scripts developed for Biostars environment. curl -O http://data.biostarhandbook.com/rnaseq/code/deseq1.r curl -O http://data.biostarhandbook.com/rnaseq/code/deseq2.r curl -O http://data.biostarhandbook. Read More...
Web Page
Bioinformatics
The bulk RNA-Seq test data we've been working with is in FASTQ format. We'd like to do a BLAST search on a couple of these sequences. Data must be in FASTA format to Read More...
Web Page
Bioinformatics
06/22/2022 - Cancer origination and progression is a complex process that can be viewed as a somatic evolutionary progression with clonal cellular expansion(s) driven by accumulation of survival-/evasion-beneficial genomic mutations, alongside constantly changing selective Read More...
Web Page
Bioinformatics
samtools view hcc1395_normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD: Read More...
Web Page
Bioinformatics
Suppose that a colleague added the following line to this_is_a_r_script.R and posted to a new branch called test_branch1 on the GitHub repository for further testing and development. library(pheatmap) Read More...
Web Page
Bioinformatics
Lesson 3: Creating a feature table Lesson Objectives Check for primers Generate an ASV count table and representative sequence file Understand the difference between OTU picking and denoising The two primary files that will be used Read More...
Web Page
Bioinformatics
This page uses content directly from the Biostar Handbook by Istvan Albert. Always remember to activate the bioinfo environment when working on Biostar class materials. conda activate bioinfo The bulk RNA-Seq test data we've Read More...
Web Page
Bioinformatics
Note that we now have differential expression by transcripts and our first column contains the transcript IDs. But what genes do these transcripts map to? We will need to do some data wrangling to find Read More...
Web Page
Bioinformatics
This page uses context taken directly from the Biostar Handbook by Istvan Albert. Remember to activate the class bioinformatics environment. conda activate bioinfo Introduction to Genomic Variation Genomic variations are typically categorized into different classes Read More...
Web Page
Bioinformatics
Lesson 7: Downloading the RNA-Seq Data and Dataset Overview Lesson Review pwd (print working directory) ls (list) touch (creates an empty file) nano (basic editor for creating small text files) using the rm command to remove Read More...
Web Page
Bioinformatics
In lesson 9, we learned that reference genomes came in the form of FASTA files, which essentially store nucleotide sequences. In this lesson, we will learn about the FASTQ file, which is the file format that Read More...
Web Page
Bioinformatics
Lesson 10: Introducing the FASTQ file and assessing sequencing data quality Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 9 Review In the previous lesson, we explored the reference genomes and Read More...
Web Page
Bioinformatics
This page contains content taken directly from the Biostar Handbook (Istvan Albert). Always remember to activate the class bioinformatics environment. conda activate bioinfo For this data analysis, we will be using: Two commercially available RNA Read More...
Web Page
Bioinformatics
This page contains content taken directly from the Biostar Handbook (Istvan Albert). Always remember to activate the class bioinformatics environment. conda activate bioinfo For this data analysis, we will be using: Two commercially available RNA Read More...
Web Page
Bioinformatics
Lesson 13: Aligning raw sequences to reference genome Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 11 Review In Lesson 11 we learned to aggregate multiple FASTQC reports into one using MultiQC, Read More...
Web Page
Bioinformatics
Lesson 13: Aligning raw sequences to reference genome Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 11 Review In Lesson 11 we learned to aggregate multiple FASTQC reports into one using MultiQC, Read More...
Web Page
Bioinformatics
This page uses content directly from the Biostar Handbook by Istvan Albert. Obtain RNA-seq test data. The test data consists of two commercially available RNA samples: Universal Human Reference (UHR) and Human Brain Reference (HBR) . Read More...
Web Page
Bioinformatics
Lesson 16: RNA sequencing review and classification based analysis Before getting started, remember to be signed on to the DNAnexus GOLD environment. Review In the previous classes, we learned about the steps involved in RNA sequencing Read More...