Search Results for: ERB-38

This page uses content directly from the Biostar Handbook by Istvan Albert. Learn: using trimmomatic to remove low-quality bases from a sequence Always remember to activate the bioinformatics environment. conda activate bioinfo We will be Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Learn: using trimmomatic to remove low-quality bases from a sequence Always remember to activate the bioinformatics environment. conda activate bioinfo We will be Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Always remember to start the bioinformatics environment when working on Biostar class material. conda activate bioinfo Let's start by creating a directory Read More...

The SRA (Sequence Read Archive) at NCBI is a large, public database of DNA sequencing data. The repository holds "short reads" generated by high-throughput next-generation sequencing, usually less than 1,000 bp. We will download Read More...

fastq-dump and fasterq-dump can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. fastq-dump SRR1553607 creates the file: SRR1553607.fastq Check the file to make Read More...

fastq-dump and fasterq-dump can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. fastq-dump SRR1553607 creates the file: SRR1553607.fastq Check the file to make Read More...

We can use the function prcomp() to run PCA on the first four columns of the iris data. The function takes numeric data. colnames(iris)[1:4] ## [1] "Sepal.Length" "Sepal.Width" "Petal. Read More...

Let's stay in the /data/username/unix_on_biowulf_2023_documents folder for this exercise (change into if not in this directory already). Note that the size of our content are listed as bytes. We Read More...

Change back to /data/username/hcc1395_fastq_download for this exercise. cd /data/username/hcc1395_fastq_download The fastq files were compressed to save on storage space as evident by the extension "gz", Read More...

Stay in the /data/username folder and take a look at hcc1395_normal_rep1_r1.fastq.gz using the command zcat, which is used to view compressed files. zcat hcc1395_normal_rep1_r1.fastq.gz Read More...

Stay in the /data/username folder and take a look at hcc1395_normal_rep1_r1.fastq.gz using the command zcat, which is used to view compressed files. zcat hcc1395_normal_rep1_r1.fastq.gz Read More...

The volcano plot helps us identify our significant genes. Generally, we are interested in identifying genes above or below certain thresholds for significance and log fold change. These thresholds can be fairly arbitrary. Here, we Read More...

The volcano plot helps us identify our significant genes. Generally, we are interested in identifying genes above or below certain thresholds for significance and log fold change. These thresholds can be fairly arbitrary. Here, we Read More...

In the tidyverse, reordering rows is largely done by arrange(). Arrange will reorder a variable from smallest to largest, or in the case of characters, alphabetically, from a to z. This is in ascending order. Read More...

Each FASTQ file is composed of many sequences. The tool seqkit and its stats function can be used to get statistics the hcc1395 FASTQ files. Change in the reads folder for this. cd reads Load Read More...

samtools view hcc1395_normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD: Read More...

The first step in analyzing RNA sequencing is to perform quality assessment of the FASTQ files. This step ensures that the quality of the data is good and there no issues with contaminations such as Read More...

To start learning how to track changes using Git, a text file called mars will be created in the directory /Users/tillodc/teaching/planets. This file will contain notes about the planet mars. Note that Read More...

2016-2024 Publications using images obtained in OMC

2024 Coutinho, L. L., Femino, E. L., Gonzalez, A. L., Moffat, R. L., Heinz, W. F., Cheng, R. Y. S., Lockett, S. J., Rangel, M. C., Ridnour, L. A. & Wink, D. A. NOS2 and Read More...

Now, that we have clusters, we can use differential expression analysis to uncover markers that define our clusters. These markers can be used to assign cell types to our clusters. First, because we are working Read More...

Learning Objectives This tutorial was designed to demonstrate common secondary analysis steps in a scRNA-Seq workflow. We will start with a merged Seurat Object with multiple data layers representing multiple samples. Throughout this tutorial we Read More...

Lesson 2: Getting Started with QIIME2 Lesson Objectives Obtain sequence data and sample metadata Import data and metadata Discuss other useful QIIME2 features including view QIIME2, provenance tracking, and the QIIME2 forum. DNAnexus DNAnexus provides a Read More...

Introduction to dplyr and the %>% Objectives Today we will begin to wrangle data using the tidyverse package, dplyr . To this end, you will learn: how to filter data frames using dplyr how to employ Read More...

The bulk RNA-Seq test data we've been working with is in FASTQ format. We'd like to do a BLAST search on a couple of these sequences. Data must be in FASTA format to Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Always remember to activate the bioinfo environment when working on Biostar class materials. conda activate bioinfo The bulk RNA-Seq test data we've Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Review: * downloading data from SRA * decompressing tar files * e-utilities * fastq-dump Learn: * sra-stat * XML format * automating SRA downloads * working with comma-separated values (csv) format * Read More...

Lesson 6: sra-tools, e-utilities, and parallel This page uses some content directly from the Biostar Handbook by Istvan Albert. Lesson 5 Review: The majority of computational tasks on Biowulf should be submitted as jobs: sbatch or swarm Read More...

Lesson 6: Downloading data from the SRA For this lesson, you will need to login to the GOLD environment on DNAnexus. Lesson 5 Review: The majority of computational tasks on Biowulf should be submitted as jobs: sbatch Read More...

Load the data For these exercises, you will explore the titanic data from kaggle.com , which was downloaded from here . You will need to download the data and load into R. As this is a Read More...

Scatter plots and plot customization Objectives Learn to customize your ggplot with labels, axes, text annotations, and themes. Learn how to make and modify scatter plots to make fairly different overall plot representations. Load a Read More...

For tabular data in the form of csv files, which could contain multiple columns, the columns do not print to the terminal nicely aligned. The column command can fix this. The options and arguments in Read More...

As mentioned, clusterProfiler also includes GSEA functions for specific functional databases. For example, we can look at the enrichment of terms from the Gene Ontology Consortium (GO) using gseGO(). For this function, we need to Read More...

fastq-dump and fasterq-dump are modules in the SRA Toolkit and can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. If working on a high Read More...

Change into hcc1395_deg from hcc1395_b4b. cd hcc1395_deg List the contents. Use the -1 option to view directory contents 1 item per line. ls -1 The files generated from deg.R are: hcc1395_ Read More...

The resulting object eh is a gseaResult object. This object contains the results (eh@result) and other information that went into the analysis, for example, @organism type, @setType, the @geneSets used, the genes in our @ Read More...

The nors data frame is not sorted. The .sort_values() attribute can be used to do this. Inside .sort_value(), the option by will be used to sort the NORS data by the variable(s) Read More...

Required arguments: geneList - the ordered ranked gene list. TERM2GENE - a data frame including the terms and genes (the custom gene sets, which in this case were from MSigDB). Optional arguments: minGSSize - Read More...

Intro_scikit-learn In [1]: ## Please uncomment the folloing line and run pip install to install scikit-plot for visualization for first run of the notebook. # Once it is installed, you can comment it out again for subsequent Read More...