Search Results for: K-ras exons 2-5

What is in the 22.gtf file? A gtf file is known as Genome Transfer File, which is essentially a tab delimited file (ie. columns in the file are separated by tab). It informs us of Read More...

Print the last eight lines of 22_transcriptome.fa. {{Sdet}}{{Ssum}}Solution{{Esum}} tail -n 8 22_transcriptome.fa >ENST00000427528.1 loc:chr22|50798655-50799123|+ exons:50798655-50799123 segs:1-469 ATGGCACCAAAAGCGAAGGAAGCTCCTGCTCATCCTAAAGCCGAAGCCAAAGCGAAGGCTTTAAAGGCCA AGAAGGCAGTGTTGAAAGGTGTCCGCAGCCACACGCAAAAAAGAAGATCCGCATGTCACTCACCTTCAGG CGGCCCAAGACACTGCGACTCCGGAGGCAGCCCAGATATCCTCGGAAGAGCACCCCCAGGAGAAACAAGC TTGGCCACTATGCTATCATCAAGTTTCCGCTGGCCACTGAGTCGGCCGTGAAGAAGATAGAAGAAAACAA CACGCTTGTGTTCACTGTGGATGTTAAAGCCAACAAGCACCAGATCAGACAGGCTGTGAAGAAGCTCTAT GACAGTGATGTGGCCAAGGTCACCACCCTGATTTGTCCTGATAAGGAGAACAAGGCATATGTTCGACTTG CTCCTGATTATGATGCTTTCGATGTTGTAACAAAATTGGGATCACCTAA {{Edet}}

The SummarizedExperiment class and the inherited class RangedSummarizedExperiment are available in the R package SummarizedExperiment . SummarizedExperiment is a matrix-like container where rows represent features of interest (e.g. genes, transcripts, exons, etc.) and columns represent Read More...

One of the things we will be doing quite often is to visualize genomics data using some sort of genome browser. In this course series, we will use a popular one called Integrative Genome Viewer( Read More...

One of the things we will be doing quite often is to visualize genomics data using some sort of genome browser. In this course series, we will use a popular one called Integrative Genome Viewer( Read More...

Why do we need a reference genome? {{Sdet}} Solution{{Esum}} The reference genome serves as a "known" that guides us in constructing the genome of the unknown from sequencing data. {{Edet}} What file Read More...

Now that we have downloaded the HBR and UHR dataset and know where analysis tools are, let's start learning about RNA sequencing, by first learning about our reference genome and annotation files. Let's Read More...

Now that we have downloaded the HBR and UHR dataset and know where analysis tools are, let's start learning about RNA sequencing, by first learning about our reference genome and annotation files. Let's Read More...

Right click on the normal_rep1.bw and tumor_rep1.bw tracks and remove them. Also remove the normal_rep1.bam track. Then, load the tumor_rep1_bowtie2.bam file into IGV. Note that the Read More...

RNA sequencing requires a splice aware aligner to accommodate reads that map across exons and STAR HISAT2 (will use this here) HISAT2 index the reference genome prior to alignment to make it more efficient. If Read More...

Use Partek Quantification to Model (E/M) algorithm since a gtf annotation is available Uses statistics to assign expression to multi-mappers rather than discarding them Output includes gene and transcript level expression quantifications Summary table Read More...

Next, goto the course data section of the class documentation. Download 22.gtf into the lesson7_practice folder using curl. This is the genomic annotation file for human chromosome 22, which tells us where features such as Read More...

One of the things we will be doing quite often is to visualize genomics data using some sort of genome browser. In this course series, we will use a popular one called Integrative Genome Viewer( Read More...

For this exercise, click on the chromosome selection drop down and choose "All". Then load normal_rep1.bam and tumor_rep1.bam to the tracks. Unlike the bigWig files, which shows pre-calculated coverage Read More...

For this exercise, click on the chromosome selection drop down and choose "All". Then load normal_rep1.bam and tumor_rep1.bam to the tracks. Unlike the bigWig files, which shows pre-calculated coverage Read More...

The diagram below shows a basic workflow for RNA sequencing analysis, which starts with FASTQ files as input. Quality check is performed on the FASTQ files ensure that sequencing quality is good and that there Read More...

The diagram below shows a basic workflow for RNA sequencing analysis, which starts with FASTQ files as input. Quality check is performed on the FASTQ files ensure that sequencing quality is good and that there Read More...

DESeq2 and another popular differential expression analysis package edgeR model expression data generated from RNA sequencing using the negative binomial distribtution. "We assume that the number of reads in sample j that are assigned Read More...

Output folder (specified by --od parameter) will contain files for each type of splicing event (marked as RI for "retained intron", SE for "skipped exon", A3SE for "alternative 3' splice Read More...

The Mouse Modeling Core assists NIH investigators by generating and preserving genetically-engineered mouse strains. Services include scientific consultation, gene-targeting in mouse embryonic stem cells, micro-injection of nucleic acids, proteins, or ES cells into mouse embryos, Read More...

The Biopharmaceutical Development Program (BDP) provides resources for the development of investigational biological agents. The BDP supports feasibility through development and Phase I/II cGMP manufacturing plus regulatory documentation.The BDP was established in 1993. We Read More...

2024 Coutinho, L. L., Femino, E. L., Gonzalez, A. L., Moffat, R. L., Heinz, W. F., Cheng, R. Y. S., Lockett, S. J., Rangel, M. C., Ridnour, L. A. & Wink, D. A. NOS2 and Read More...

Which reference genome are we using in this IGV session to view the alignment results for samples hcc1395_normal_rep1 and hcc1395_tumor_rep2? On what chromosome are the sequencing data mapping to? {{Sdet}} Solution{{ Read More...

For RNA sequencing studies, we need to use a splice aware aligner to account for reads that map across exons. Bowtie2 is a commonly used aligner for DNA sequencing and is not splice aware. Let' Read More...

Let's start our exploration of sequencing read alignment by discussing the reference genome for human chromosome 22. For this, change into our ~/biostar_class/hbr_uhr/refs folder. In Lesson 9, we discussed why we need Read More...

Let's start our exploration of sequencing read alignment by discussing the reference genome for human chromosome 22. For this, change into our ~/biostar_class/hbr_uhr/refs folder. In Lesson 9, we discussed why we need Read More...

For RNA sequencing studies, we need to use a splice aware aligner to account for reads that map across exons. Bowtie2 is a commonly used aligner for DNA sequencing and is not splice aware. Let' Read More...

Lesson 12: RNA sequencing review 1 Learning objectives Here, we will do a quick review of what we have learned about RNA sequencing in Lessons 8 through 11. Accessing the Biostar handbook The URL for the Biostar handbook is Read More...

Note that we now have differential expression by transcripts and our first column contains the transcript IDs. But what genes do these transcripts map to? We will need to do some data wrangling to find Read More...

Lesson 14 Practice Objectives Here, we will practice using the Integrative Genome Viewer (IGV) to visualize the hcc1395 RNA sequencing alignment results. About the data and launching IGV We were introduced to the hcc1395 RNA sequencing Read More...

Lesson 9: Reference genomes and genome annotations used in RNA sequencing Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 8 Review In Lesson 8, we learned about the basics of RNA sequencing, Read More...

Lesson 9: Reference genomes and genome annotations used in RNA sequencing Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 8 Review In Lesson 8, we learned about the basics of RNA sequencing, Read More...

In this portion of the class, it is very important that you have IGV already opened on your computer. See Figure 1 and Figure 2 on how to load the relevant alignment outputs for HBR_1 and UHR_1 Read More...

For visualizing the HBR and UHR alignment results, we will use the built in Human hg38 genome. To do this, we will just goto the genome selection box and select hg38 (Figure 2). In Figure 3, we Read More...

Gene expression table can be generated from the read alignment. Options for generating an expression table. Because there a GTF annotation file is avaialable, this exercise will use the Quantify to annotation model (Partek E/ Read More...

No summary available.

As you can see from the image, there are several accessor functions to access the data from the object: assays() - access matrix-like experimental data (e.g., count data). Rows are genomic features (e.g., Read More...

Objectives To explore Bioconductor, a repository for R packages related to biological data analysis. To better understand S4 objects as they relate to the Bioconductor core infrastructure. To learn more about a popular Bioconductor S4 Read More...

Let's align an RNA-Seq sample using the "splice aware" aligner hisat2. First we will need to create the indices. Use this format: hisat2-build REFERENCE_GENOME INDEX_PREFIX Like this: hisat2-build Read More...

Let's align an RNA-Seq sample using the "splice aware" aligner hisat2. First we will need to create the indices. Use this format: hisat2-build REFERENCE_GENOME INDEX_PREFIX Like this: hisat2-build Read More...

Let's align an RNA-Seq sample using the "splice aware" aligner hisat2. First we will need to create the indices. Use this format: hisat2-build REFERENCE_GENOME INDEX_PREFIX Like this: hisat2-build Read More...

Alignment RNASeq Mapping Challenges The majority of mRNA derived from eukaryotes is the result of splicing together discontinuous exons, and this creates specific challenges for the alignment of RNASEQ data. Mapping Challenges Reads not perfect Read More...

Lesson 16: RNA sequencing review and classification based analysis Before getting started, remember to be signed on to the DNAnexus GOLD environment. Review In the previous classes, we learned about the steps involved in RNA sequencing Read More...

Lesson 13: Aligning raw sequences to reference genome Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 11 Review In Lesson 11 we learned to aggregate multiple FASTQC reports into one using MultiQC, Read More...

Lesson 13: Aligning raw sequences to reference genome Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 11 Review In Lesson 11 we learned to aggregate multiple FASTQC reports into one using MultiQC, Read More...

Lesson 14: Visualizing alignment results Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 13 Review Previously, we used the application HISAT2 to align the raw sequencing data from the Human Brain Read More...

Lesson 14: Visualizing alignment results Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 13 Review Previously, we used the application HISAT2 to align the raw sequencing data from the Human Brain Read More...

This page contains content taken directly from the Biostar Handbook (Istvan Albert). Always remember to activate the class bioinformatics environment. conda activate bioinfo For this data analysis, we will be using: Two commercially available RNA Read More...

This page contains content taken directly from the Biostar Handbook (Istvan Albert). Always remember to activate the class bioinformatics environment. conda activate bioinfo For this data analysis, we will be using: Two commercially available RNA Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Obtain RNA-seq test data. The test data consists of two commercially available RNA samples: Universal Human Reference (UHR) and Human Brain Reference (HBR) . Read More...

The program can be run in either interactive or batch mode Get interactive node: sinteractive -c 16 --mem 45g --gres=lscratch:20 Make sure you have requested enough resources, as the program can be quite memory- and Read More...