Search Results for: LMB-2 (Anti-TAC Fv PE-38)

Let's use the tool Trimmomatic to clean up the adapters and the poor quality reads for SRR1553606. For help with Trimmomatic type trimmomatic --help at the command line. Before getting started with using trimmomatic, Read More...

For this exercise, go back to the ~/biostar_class/hcc1395 folder and create a new directory called trimmed_data. {{Sdet}} Solution{{Esum}} cd ~/biostar_class/hcc1395 mkdir trimmed_data cd trimmed_data {{Edet}} The adapters Read More...

05/31/2023 - Please join us on May 31 when Harvard University’s John Quackenbush, Ph.D., will present “ Why Networks Matter: Embracing Biological Complexity. ” Dr. Quackenbush will share multiple examples illustrating the importance of network models. He Read More...

Explore the data. What is the structure of the data? Try str() . What are the column names? Try colnames() . How can you get help if you do not know how to use these functions? {{Sdet}} Read More...

01/25/2021 - Presenter: Dr. Arjun Raj from the Perelman School of Medicine, UPenn. Abstract:Anti-cancer therapies can often kill the vast majority of tumor cells but a few rare cells remain and grow despite treatment. Non-genetic Read More...

sessionInfo() R version 4.4.0 (2024-04-24) Platform: aarch64-apple-darwin20 Running under: macOS Sonoma 14.7.1 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/lib/ Read More...

QC all reads K-mer length, if specified will generate a report for each sample of the positions for the most commonly occurring k-mers (or sequence of nucleotides) of the specified length - can hint at Read More...

To run remove adapters for all FASTQ files in one go, the parallel command will be introduced. This command enables the analyst to run multiple tasks in parallel such as trimming of high throughput sequencing Read More...

To run Trimmomatic, the parallel command will be introduced. This command enables analyst to run multiple tasks in parallel such as trimming of high throughput sequencing data. The command construct is broken down below. cat Read More...

Past versions of dplyr included powerful variants of filter, select, and other functions to help perform tasks across columns. You may see functions such as filter_all, filter_if, and filter_at. Functions like these Read More...

sessionInfo() R version 4.2.3 (2023-03-15) Platform: x86_64-apple-darwin17.0 (64-bit) Running under: macOS Big Sur ... 10.16 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/ Read More...

Each FASTQ file is composed of many sequences. The tool seqkit and its stats function can be used to get statistics the hcc1395 FASTQ files. Change in the reads folder for this. cd reads Load Read More...

Each FASTQ file is composed of many sequences. The tool seqkit and its stats function can be used to get statistics the hcc1395 FASTQ files. Change in the reads folder for this. cd reads Load Read More...

The Antibody Engineering Program (AEP) is located at the Laboratory of Molecular Biology, which is part of the Center for Cancer Research (CCR), an intramural program at the National Cancer Institute (NCI). AEP focuses on Read More...

Back Services: Biophysics Facility offers Octet as an open-access instrument.  First-time users must complete a short training session before gaining access to the instrument reservation calendar.  Training includes a full analysis of a Read More...

The Medicinal Chemistry Accelerator (MCA) is a collaborative CCR resource that supports investigators in developing small molecule inhibitors for anticancer drug candidates. While CCR and NCATS have infrastructure to identify initial “hits” through high-throughput screening, Read More...

NCI LASP Animal Research Technology Support (ARTS) provides customized technical support for basic and translational animal-based research to the scientific community. We offer a wide array of services ranging from expert colony management to the Read More...

The Laboratory Animal Sciences Program (LASP) of the Frederick National Laboratory operates a Gnotobiotics Facility (GF) to support research focused on the role of microbiota in cancer inflammation, pathogenesis, and treatment response. The GF can Read More...

The Advanced Biomedical Computational Science (ABCS) group focuses on applications of bioinformatics, computational and data science, and artificial intelligence to support NCI researchers. ABCS provides: • Subject matter expertise in genomics, proteomics, and imaging. • Machine learning/ Read More...

In comma separated files the columns are separated by commas and the rows are separated by new lines. To read comma separated files, we can use the specific functions ?read.csv() and ?read_csv() . Let' Read More...

Now that we know what we mean by denoising, let's apply it to our data. We will use DADA2 , which seems to be the more popular method. To use DADA2, we need to make Read More...

Lesson 2: Getting Started with QIIME2 Lesson Objectives Obtain sequence data and sample metadata Import data and metadata Discuss other useful QIIME2 features including view QIIME2, provenance tracking, and the QIIME2 forum. DNAnexus DNAnexus provides a Read More...

There are many steps that can be taken following subsetting (i.e., filtering by rows and columns); one of which is reordering rows. In the tidyverse, reordering rows is largely done by arrange() . Arrange will Read More...

RNA-SEQ Overview What is RNASEQ ? RNA-Seq (RNA sequencing), uses next-generation sequencing (NGS) to reveal the presence and quantity of RNA in a biological sample at a given moment. (Wikipedia) Strictly speaking this could be any Read More...

Let's go back to the biostar_class directory and create a folder called practice_trimming for this exercise. How do we do this? {{Sdet}} Solution{{Esum}} This depends on where you are currently (ie. Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Learn * What are sequence adapters? * Do we need to trim them before alignment? * How can I trim with a new adapter sequence? Be Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Learn * What are sequence adapters? * Do we need to trim them before alignment? * How can I trim with a new adapter sequence? Be Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Always remember to start the bioinformatics environment when working on Biostar class material. conda activate bioinfo Let's start by creating a directory Read More...

Lesson 11 Practice Objectives In this lesson, we learned to merge multiple FASTQC reports into one perform data cleanup (quality and adapter trimming) to prepare our sequencing reads for downstream analysis. Here, we will put what Read More...

The SRA (Sequence Read Archive) at NCBI is a large, public database of DNA sequencing data. The repository holds "short reads" generated by high-throughput next-generation sequencing, usually less than 1,000 bp. We will download Read More...

fastq-dump and fasterq-dump can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. fastq-dump SRR1553607 creates the file: SRR1553607.fastq Check the file to make Read More...

fastq-dump and fasterq-dump can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. fastq-dump SRR1553607 creates the file: SRR1553607.fastq Check the file to make Read More...

Lesson 11: Merging FASTQ quality reports and data cleanup Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 10 Review In the previous lesson, we learned about the structure of the FASTQ Read More...

Lesson 12 Practice Objectives In this practice session, we will work with something new, which is a dataset from the Griffith lab RNA sequencing tutorial. Here, we will have a chance to practice what we have Read More...

We can use the function prcomp() to run PCA on the first four columns of the iris data. The function takes numeric data. colnames(iris)[1:4] ## [1] "Sepal.Length" "Sepal.Width" "Petal. Read More...

04/03/2023 - Workshop Description:  The application of AI to cancer research holds promise to accelerate new discoveries, enable early detection, improve diagnosis, and spur development of new therapies for cancer. Machine learning and other forms of Read More...

06/17/2021 - Register Now Faculty: Dana Pe’er, PhD – Memorial Sloan Kettering Cancer Center; NCI Cancer Moonshot HTAN Moderator: Daniel Wells, PhD – Immunai Target Audience This series will serve as an excellent resource for all stakeholders Read More...

05/06/2021 - Presenter : Adam J Gayoso, Streets and Yosef Groups at UC Berkeley Abstract : Probabilistic models have demonstrated state-of-the-art performance for many single-cell omics data analysis tasks, including dimensionality reduction, clustering, differential expression, annotation, removal of Read More...

09/22/2015 - Learn the basics of microarray gene expression analysis using Partek Genomics Suite and Open Source Tools. As we walk though hands-on analysis of a cancer dataset, you will learn the principles of experimental design, Read More...

The Advanced Biomedical Computational Science (ABCS) group focuses on applications of bioinformatics, computational and data science, and artificial intelligence to support NCI researchers. ABCS provides: Subject matter expertise in genomics, proteomics, and imaging. Machine learning/ Read More...

Let's stay in the /data/username/unix_on_biowulf_2023_documents folder for this exercise (change into if not in this directory already). Note that the size of our content are listed as bytes. We Read More...

Change back to /data/username/hcc1395_fastq_download for this exercise. cd /data/username/hcc1395_fastq_download The fastq files were compressed to save on storage space as evident by the extension "gz", Read More...

Stay in the /data/username folder and take a look at hcc1395_normal_rep1_r1.fastq.gz using the command zcat, which is used to view compressed files. zcat hcc1395_normal_rep1_r1.fastq.gz Read More...

Stay in the /data/username folder and take a look at hcc1395_normal_rep1_r1.fastq.gz using the command zcat, which is used to view compressed files. zcat hcc1395_normal_rep1_r1.fastq.gz Read More...

In comma separated files the columns are separated by commas and the rows are separated by new lines. To read comma separated files, we can use the specific functions ?read.csv() and ?read_csv(). Let' Read More...

view normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:151 YS: Read More...

samtools view hcc1395_normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD: Read More...

Participants will practice trimming using trimmomatic in this help session but with data downloaded from the SRA instead as the HBR-UHR FASTQC report indicated that there are no adapter contamination. Before getting started, be sure Read More...

The first step in analyzing RNA sequencing is to perform quality assessment of the FASTQ files. This step ensures that the quality of the data is good and there no issues with contaminations such as Read More...

To start learning how to track changes using Git, a text file called mars will be created in the directory /Users/tillodc/teaching/planets. This file will contain notes about the planet mars. Note that Read More...

Let's reshape the data. I will rely heavily on dplyr functions to perform these tasks. First, I want to isolate the alpha chain and beta chain data. #isolate alpha and beta dfTRA< Read More...

As mentioned, clusterProfiler also includes GSEA functions for specific functional databases. For example, we can look at the enrichment of terms from the Gene Ontology Consortium (GO) using gseGO(). For this function, we need to Read More...

The Pan-Microbial Serology Facility (PMSF) is part of the Center for Cancer Research (CCR) at the National Cancer Institute (NCI). The PMSF focuses on determining individualized pan-microbial immune profiles associated with human diseases including immunological Read More...

Now, that we have clusters, we can use differential expression analysis to uncover markers that define our clusters. These markers can be used to assign cell types to our clusters. First, because we are working Read More...

Learning Objectives This tutorial was designed to demonstrate common secondary analysis steps in a scRNA-Seq workflow. We will start with a merged Seurat Object with multiple data layers representing multiple samples. Throughout this tutorial we Read More...

Lesson 3: Creating a feature table Lesson Objectives Check for primers Generate an ASV count table and representative sequence file Understand the difference between OTU picking and denoising The two primary files that will be used Read More...

Data import and reshape Objectives 1. Learn to import multiple data types 2. Data reshape with tidyr : pivot_longer() , pivot_wider() , separate() , and unite() Installing and loading packages So far we have only worked with objects that Read More...

Introduction to dplyr and the %>% Objectives Today we will begin to wrangle data using the tidyverse package, dplyr . To this end, you will learn: how to filter data frames using dplyr how to employ Read More...

The bulk RNA-Seq test data we've been working with is in FASTQ format. We'd like to do a BLAST search on a couple of these sequences. Data must be in FASTA format to Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Always remember to activate the bioinfo environment when working on Biostar class materials. conda activate bioinfo The bulk RNA-Seq test data we've Read More...

This page uses content directly from the Biostar Handbook by Istvan Albert. Review: * downloading data from SRA * decompressing tar files * e-utilities * fastq-dump Learn: * sra-stat * XML format * automating SRA downloads * working with comma-separated values (csv) format * Read More...

Lesson 16: RNA sequencing review and classification based analysis Before getting started, remember to be signed on to the DNAnexus GOLD environment. Review In the previous classes, we learned about the steps involved in RNA sequencing Read More...

Lesson 6: sra-tools, e-utilities, and parallel This page uses some content directly from the Biostar Handbook by Istvan Albert. Lesson 5 Review: The majority of computational tasks on Biowulf should be submitted as jobs: sbatch or swarm Read More...

Lesson 6: Downloading data from the SRA For this lesson, you will need to login to the GOLD environment on DNAnexus. Lesson 5 Review: The majority of computational tasks on Biowulf should be submitted as jobs: sbatch Read More...

Load the data For these exercises, you will explore the titanic data from kaggle.com , which was downloaded from here . You will need to download the data and load into R. As this is a Read More...

Scatter plots and plot customization Objectives Learn to customize your ggplot with labels, axes, text annotations, and themes. Learn how to make and modify scatter plots to make fairly different overall plot representations. Load a Read More...

fastq-dump and fasterq-dump are modules in the SRA Toolkit and can be used to download FASTQ-formatted data. Both download the data in SRA format and convert it to FASTQ format. If working on a high Read More...

Change into hcc1395_deg from hcc1395_b4b. cd hcc1395_deg List the contents. Use the -1 option to view directory contents 1 item per line. ls -1 The files generated from deg.R are: hcc1395_ Read More...

The resulting object eh is a gseaResult object. This object contains the results (eh@result) and other information that went into the analysis, for example, @organism type, @setType, the @geneSets used, the genes in our @ Read More...

For tabular data in the form of csv files, which could contain multiple columns, the columns do not print to the terminal nicely aligned. The column command can fix this. The options and arguments in Read More...

Required arguments: geneList - the ordered ranked gene list. TERM2GENE - a data frame including the terms and genes (the custom gene sets, which in this case were from MSigDB). Optional arguments: minGSSize - Read More...