NATIONAL CANCER INSTITUTE - CANCER.GOV

Search Results for: LMB-2 (Anti-TAC Fv PE-38)

Total Results Found: 82

Biopharmaceutical Development Program (BDP)
Frederick, MD

Collaborative

The Biopharmaceutical Development Program (BDP) provides resources for the development of investigational biological agents. The BDP supports feasibility through development and Phase I/II cGMP manufacturing plus regulatory documentation. The BDP was established in 1993. We Read More...

Antibody Engineering Program
Bethesda, MD

Collaborative

The Antibody Engineering Program (AEP) is located at the Laboratory of Molecular Biology, which is part of the Center for Cancer Research (CCR), an intramural program at the National Cancer Institute (NCI). AEP focuses on Read More...

Bio-Layer Interferometry (BLI) - Octet RED96

Web Page

Back Services: Biophysics Facility offers Octet as an open-access instrument.  First-time users must complete a short training session before gaining access to the instrument reservation calendar.  Training includes a full analysis of a Read More...

NCI Medicinal Chemistry Accelerator (MCA)
Frederick, MD

Collaborative

The Medicinal Chemistry Accelerator (MCA) is a collaborative CCR resource that supports investigators in developing small molecule inhibitors for anticancer drug candidates. While CCR and NCATS have infrastructure to identify initial “hits” through high-throughput screening, Read More...

NCI LASP Animal Research Technology Support (ARTS)
Frederick, MD

Core Facility

NCI LASP Animal Research Technology Support (ARTS) provides customized technical support for basic and translational animal-based research to the scientific community. We offer a wide array of services ranging from expert colony management to the Read More...

NCI LASP Gnotobiotics Facility (GF)
Frederick, MD

Core Facility

The Laboratory Animal Sciences Program (LASP) of the Frederick National Laboratory operates a Gnotobiotics Facility (GF) to support research focused on the role of microbiota in cancer inflammation, pathogenesis, and treatment response. The GF can Read More...

Representing and Embedding Tissue Structures

Web Page

Bioinformatics

06/25/2024 - Register for the June Emerging Technologies Seminar to hear from Dr. Dana Pe’er of the Memorial Sloan Kettering Cancer Center. She will describe new bioinformatics tools for exploring the complex tumor Read More...

Bioinformatics for Beginners 2022: Trimming

Web Page

Bioinformatics

For this exercise, go back to the ~/biostar_class/hcc1395 folder and create a new directory called trimmed_data. {{Sdet}} Solution{{Esum}} cd ~/biostar_class/hcc1395 mkdir trimmed_data cd trimmed_data {{Edet}} The adapters Read More...

Why Networks Matter: Embracing Biological Complexity

Web Page

Bioinformatics

05/31/2023 - Please join us on May 31 when Harvard University’s John Quackenbush, Ph.D., will present “ Why Networks Matter: Embracing Biological Complexity. ” Dr. Quackenbush will share multiple examples illustrating the importance of network models. He Read More...

Data Visualization with R: Question 2

Web Page

Bioinformatics

Explore the data. What is the structure of the data? Try str() . What are the column names? Try colnames() . How can you get help if you do not know how to use these functions? {{Sdet}} Read More...

SINGLE-CELL RNA SEQUENCING

Web Page

Bioinformatics

06/17/2021 - Register Now Faculty: Dana Pe’er, PhD – Memorial Sloan Kettering Cancer Center; NCI Cancer Moonshot HTAN Moderator: Daniel Wells, PhD – Immunai Target Audience This series will serve as an excellent resource for all stakeholders Read More...

BTEP Lessons: Session Info

Web Page

Bioinformatics

sessionInfo() R version 4.4.0 (2024-04-24) Platform: aarch64-apple-darwin20 Running under: macOS Sonoma 14.7.1 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/lib/ Read More...

BTEP Coding Club: R Session info

Web Page

Bioinformatics

sessionInfo() R version 4.2.3 (2023-03-15) Platform: x86_64-apple-darwin17.0 (64-bit) Running under: macOS Big Sur ... 10.16 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/4.2/Resources/lib/ Read More...

The Advanced Biomedical Computational Science (ABCS) Group

Web Page

Bioinformatics

The Advanced Biomedical Computational Science (ABCS) group focuses on applications of bioinformatics, computational and data science, and artificial intelligence to support NCI researchers. ABCS provides: • Subject matter expertise in genomics, proteomics, and imaging. • Machine learning/ Read More...

Microbiome Analysis with QIIME2: Metadata and importing

Web Page

Bioinformatics

Lesson 2: Getting Started with QIIME2 Lesson Objectives Obtain sequence data and sample metadata Import data and metadata Discuss other useful QIIME2 features including view QIIME2, provenance tracking, and the QIIME2 forum. DNAnexus DNAnexus provides a Read More...

Data Wrangling with R: Reordering rows

Web Page

Bioinformatics

There are many steps that can be taken following subsetting (i.e., filtering by rows and columns); one of which is reordering rows. In the tidyverse, reordering rows is largely done by arrange() . Arrange will Read More...

Bioinformatics for Beginners 2022: RNA-SEQ Overview

Web Page

Bioinformatics

RNA-SEQ Overview What is RNASEQ ? RNA-Seq (RNA sequencing), uses next-generation sequencing (NGS) to reveal the presence and quantity of RNA in a biological sample at a given moment. (Wikipedia) Strictly speaking this could be any Read More...

Bioinformatics for Beginners 2022: What is the SRA?

Web Page

Bioinformatics

The SRA (Sequence Read Archive) at NCBI is a large, public database of DNA sequencing data. The repository holds "short reads" generated by high-throughput next-generation sequencing, usually less than 1,000 bp. We will download Read More...

Data Visualization with R: Perform PCA

Web Page

Bioinformatics

We can use the function prcomp() to run PCA on the first four columns of the iris data. The function takes numeric data. colnames(iris)[1:4] ## [1] "Sepal.Length" "Sepal.Width" "Petal. Read More...

Microarray Workshop (2 day)

Web Page

Bioinformatics

09/22/2015 - Learn the basics of microarray gene expression analysis using Partek Genomics Suite and Open Source Tools. As we walk though hands-on analysis of a cancer dataset, you will learn the principles of experimental design, Read More...

Bioinformatics for Beginners, January 2025: SAM File Information

Web Page

Bioinformatics

samtools view hcc1395_normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD: Read More...

BTEP Coding Club: Tracking changes

Web Page

Bioinformatics

To start learning how to track changes using Git, a text file called mars will be created in the directory /Users/tillodc/teaching/planets. This file will contain notes about the planet mars. Note that Read More...

BTEP Coding Club: Return to R

Web Page

Bioinformatics

Let's reshape the data. I will rely heavily on dplyr functions to perform these tasks. First, I want to isolate the alpha chain and beta chain data. #isolate alpha and beta dfTRA< Read More...

BTEP Coding Club: GSEA with GO

Web Page

Bioinformatics

As mentioned, clusterProfiler also includes GSEA functions for specific functional databases. For example, we can look at the enrichment of terms from the Gene Ontology Consortium (GO) using gseGO(). For this function, we need to Read More...

BTEP Coding Club: Results

Web Page

Bioinformatics

The resulting object eh is a gseaResult object. This object contains the results (eh@result) and other information that went into the analysis, for example, @organism type, @setType, the @geneSets used, the genes in our @ Read More...

BTEP Coding Club: Sort Data

Web Page

Bioinformatics

The nors data frame is not sorted. The .sort_values() attribute can be used to do this. Inside .sort_value(), the option by will be used to sort the NORS data by the variable(s) Read More...

BTEP Coding Club: Arguments

Web Page

Bioinformatics

Required arguments: geneList - the ordered ranked gene list. TERM2GENE - a data frame including the terms and genes (the custom gene sets, which in this case were from MSigDB). Optional arguments: minGSSize - Read More...

BTEP Coding Club: Jupyter Notebook Part 1

Web Page

Bioinformatics

Intro_scikit-learn In [1]: ## Please uncomment the folloing line and run pip install to install scikit-plot for visualization for first run of the notebook. # Once it is installed, you can comment it out again for subsequent Read More...