Search Results for: library preparation

A typical RNASEQ experiment involves several steps, only one of which falls within the realm of bioinformatics. Namely the Data Analysis step. Experimental Design What question am I asking How should I do it (does Read More...

Biostar Class - Sequencing Instruments Below are a list of links and resources mentioned in the BIOSTAR Sequencing Instruments class given on 06/10/20 and 06/11/20 Sequencing Technologies - Company Web Sites Illumina PacBio Oxford Nanopore 10X Genomics Read More...

Overview of wet lab procedures Library preparation process, including Adapters and indices Single and paired end sequencing Strandedness Coverage and depth Spike-ins Replicates Batch effects Overview of analysis procedures References and annotation files needed for Read More...

11/10/2022 - Learn how to include generalist repositories in data sharing plans as part of your preparation for the new NIH Data Management and Sharing Policy beginning in January 2023. This webinar will include guidance on selecting Read More...

06/20/2013 - This is repeat of the lecture given June 11th on the Bethesda Campus. Common sample prep and library preparation pitfalls Understand what determines the quality of your NGS data Current publishing and data reporting Read More...

06/11/2013 -   Common sample prep and library preparation pitfalls Understand what determines the quality of your NGS data Current publishing and data reporting standards for NGS studies Types of experimental designs used NGS studies Ensure efficient Read More...

The next figure shows "Per base sequence content", which is essentially the sequence make up along the bases of reads in the FASTQ file. If a library is random, then the percent composition Read More...

The next figure shows "Per base sequence content", which is essentially the sequence make up along the bases of reads in the FASTQ file. If a library is random, then the percent composition Read More...

library(tidyverse) # dplyr and ggplot2 library(Seurat) # Seurat toolkit library(hdf5r) # for data import library(patchwork) # for plotting library(presto) # for differential expression library(glmGamPoi) # for sctransform Warning: package 'glmGamPoi' was built under R Read More...

library(tidyverse) # dplyr and ggplot2; CRAN library(Seurat) # Seurat toolkit; CRAN library(hdf5r) # for data import; CRAN library(patchwork) # for plotting; CRAN library(presto) # for differential expression; Github library(glmGamPoi) # for sctransform; Bioconductor library( Read More...

03/29/2024 - This first of five webinars will introduce NIH’s All of Us Research Program, including the program’s mission and core values. Learn about the current size and diversity of Read More...

The OSTR offers cutting-edge technology platforms to the CCR scientific community through centralized facilities. The videos accessed through this page are designed to introduce the various scientific methodologies OSTR makes available through the cores on Read More...

02/12/2013 -   This lecture will provide an overview of Illumina sequencing technology as implemented at the CCR Sequencing Facility (SF). It will outline the data and sample QC and analysis workflow performed by the facility and Read More...

BioProject (Prefix: PRJNA, example: PRJNA257197): provides a description of the research project associated with the sequencing study. It includes information such as the study’s abstract, links to publications (if available), and links to project Read More...

Seurat can be installed directly from CRAN. install.packages("Seurat") If you would like to install the development version or previous versions, see the installation instructions available here . Load the package from your Read More...

High resolution single cell profiling assays have provided an unprecedented view of many biological systems and processes, but the spatial context in which this biology is occurring is often crucial. Spatial profiling, including spatial transcriptomic Read More...

Note that each section of the report is marked by color coded flags (i.e., green, yellow, red). Yellow and red flags, which indicate "warning" and "fail" respectively, may indicate a Read More...

view normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:151 YS: Read More...

samtools view hcc1395_normal_rep1.sam | head -1 | column -t | less -S K00193:38:H3MYFBBXX:4:1101:10003:44458 99 chr22 31282436 60 151M = 31282463 178 TTCCTTATGAAACAGGAAGAGTCCCTGGGCCCAGGCCTGGCCCACGGTTGTCAAGGCACATCATTGCCAGCAAGCTGAAGCATACCAGCAGCCACAACCTAGATCTCATTCCCAACCCAAAGTTCTGACTTCTGTACAAACTCGTTTCCAG AAFFFKKKKKKKKKKKKKKKKKKKKKKKKFKKFKKKKF<AAKKKKKKKKKKKKKKKKFKKKFKKKKKKKKKKKFKAFKKKKKKKKKKKKKKKKKKKKKKKKKKKFKKKKKKKKKKKKFKKKKKKKKKKKKFKFFKKKKKKKKKKKKFKKKK AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD: Read More...

07/31/2025 - NIDDK Biostats Seminar Series: From Research Study Design to Collecting, Managing, and Analyzing Data. Learning Objectives: Be able to identify, load, and use R resources/packages based upon needs and experience level with R.& Read More...

03/19/2025 - This one hour and a half online training provides an accessible introduction to artificial intelligence (AI) using MATLAB. Designed for beginners, the session covers fundamental concepts in AI and machine learning, introduces intuitive tools Read More...

To take full advantage of R, you need to install R packages. R packages are loadable extensions that contain code, data, documentation, and tests in a standardized shareable format that can easily be installed by Read More...

The tidyverse includes a collection of packages. To use these packages, we need to load the packages using the library() function. library(tidyverse)

To begin plotting, let's load our tidyverse library. #load libraries library(tidyverse) # Tidyverse automatically loads ggplot2 ## ── Attaching core tidyverse packages ──────────────────────── tidyverse 2.0.0 ── ## ✔ dplyr 1.1.3 ✔ readr 2.1.4 ## ✔ forcats 1.0.0 ✔ stringr 1.5.0 ## ✔ ggplot2 3.4.4 ✔ tibble 3.2.1 ## ✔ lubridate 1.9.3 ✔ tidyr 1.3.0 ## ✔ purrr 1.0.2 ## ── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ── ## ✖ dplyr:: Read More...

{{Sdet}} Solution{{Esum}} library ( ggplot2 ) ggplot ( iris ) + geom_point ( aes ( Petal.Length , Petal.Width , color = Species )) {{Edet}}

The Genomics Technology Laboratory is an integrated, high-throughput molecular biology laboratory focusing on the development of genetics and genomics technologies, data analysis, and information management tools, in support of CCR Investigators. The laboratory develops integrated Read More...

NISC’s role within NHGRI, and more broadly across NIH, aims to advance genome sequencing and its many applications, with a goal not simply to produce sequence data, but to produce the infrastructure required to Read More...

The Cancer and Inflammation Program – Microbiome and Genetics Core (CIP-MGC) grew out of the former CIP Genetics Core to meet the increasing need for sequencing and analysis of commensal microbiota within CIP and NCI. The Read More...

CREx News & Updates May 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Click below to learn how easy it is to navigate the CREx platform. These short videos will Read More...

The Genomics Laboratory (formerly Laboratory of Molecular Technology) is an integrated, high-throughput molecular biology laboratory focusing on the development of genetics and genomics technologies, together with associated laboratory automation systems, data analysis, and information management Read More...

The Functional Genomics Laboratory (formerly, the RNAi Screening Facility) of the National Center for Advancing Translational Sciences (NCATS) assist investigators with all stages of project planning and execution, beginning with assay development through genome-wide siRNA Read More...

September 8, 2022 crex.nih.gov CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Science & Technology Seminars and Training Events Upcoming Seminars and Educational Opportunities The following Read More...

CREx News & Updates August 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Site Spotlight NCATS Functional Genomics Laboratory (FGL) FGL is designed to help NIH Investigators use the latest Read More...

October 6, 2022 crex.nih.gov CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Science & Technology Seminars and Training Events Upcoming Seminars and Educational Opportunities The following Read More...

The NIH Center for Human Immunology, Inflammation, and Autoimmunity (CHI) is a trans-NIH resource whose mission is to provide a collaborative hub of advanced translational immunology for NIH clinical and pre-clinical studies. This uniquely structured Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More New CREx User Survey The CREx Team is carrying out a CREx User Survey. If you haven’t Read More...

NCI LASP Genome Modification Core (GMC) is a CCR-dedicated facility that provides advice, training, and reagents to NCI scientists seeking to utilize CRISPR and other nucleases to generate genome modifications in primary cells, cell lines, Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Research Festival The NIH Research Festival highlights the groundbreaking science and the vibrant NIH community driving our Read More...

CREx News & Updates June 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Click below to learn how easy it is to navigate the CREx platform. These short videos will Read More...

The NCI Clinical Research Correlatives Core provides non-CLIA-certified spectral flow cytometric assays to support clinical trials conducted in the CCR. The core specializes in immunophenotyping and immune monitoring assays. Established Technologies Spectral flow cytometry (Cytek), Read More...

NanoString Technology The nCounter® Analysis System is an automated, multi-application, digital detection and counting system which directly profiles up to 800 molecules simultaneously from a single sample using a novel barcoding technology. Profile hundreds of mRNAs, Read More...

CREx News & Updates April 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Click below to learn how easy it is to navigate the CREx platform. These short videos will Read More...

The NCI High-Throughput Imaging Facility (HiTIF) works in a collaborative fashion with NCI/NIH Investigators by providing them with the necessary expertise, instrumentation, and software to develop and execute advanced High-Throughput Imaging (HTI) assays. These Read More...

The NIH Intramural Research Program Collaborative Research Exchange (CREx) The Collaborative Research Exchange (CREx) is an online CCR marketplace where investigators can search, browse, and request information for research services, technologies, or custom products (antibody Read More...

Protein Expression Laboratory The Protein Expression Laboratory develops, improves, and delivers protein-centric services. Our goal is to help client investigators achieve their research goals with the lowest possible cost in the shortest time. All PEL Read More...

Long read sequencing was recently named 2022’s method of the year by Nature Methods . Long read sequencing technologies, those that generate sequence reads with lengths of 10s of kilobases or longer have several advantages over Read More...

Lesson 3: Creating a feature table Lesson Objectives Check for primers Generate an ASV count table and representative sequence file Understand the difference between OTU picking and denoising The two primary files that will be used Read More...

Bioinformatics for beginners Module 2: Introduction to RNA sequencing In this module, we will use the Human Brain Reference and Universal Human Reference RNA sequencing datasets to learn about RNA sequencing. Each lesson will be followed Read More...

RNA-SEQ Overview What is RNASEQ ? RNA-Seq (RNA sequencing), uses next-generation sequencing (NGS) to reveal the presence and quantity of RNA in a biological sample at a given moment. (Wikipedia) Strictly speaking this could be any Read More...

Let's use the tool Trimmomatic to clean up the adapters and the poor quality reads for SRR1553606. For help with Trimmomatic type trimmomatic --help at the command line. Before getting started with using trimmomatic, Read More...

In lesson 9, we learned that reference genomes came in the form of FASTA files, which essentially store nucleotide sequences. In this lesson, we will learn about the FASTQ file, which is the file format that Read More...

06/06/2016 - The 'NCBI Resources for CCR Scientists' workshop, on June 6 and June 8, 2016, will focus on teaching a wide range of resources developed within NCBI that are relevant for CCR scientists. It will include both hands-on Read More...

After mapping, the next step is to perform post-alignment QC to determine things like overall alignment rate (ie. how many sequences aligned to the reference). To do this, select the "Aligned" reads data Read More...

06/11/2025 - This two-hour virtual roundtable discussion will cover development and implementation of artificial intelligence (AI) chatbots at NIH. A chatbot is a software application or web interface designed to have textual or spoken conversations and Read More...

05/05/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

05/01/2025 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering this two-part online training for non-statisticians interested in understanding the basic, intuitive thinking behind the Read More...

04/28/2025 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering a several trainings that cover general concepts behind statistics and epidemiology. These trainings will help Read More...

04/28/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

04/25/2025 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering this two-part online training for non-statisticians interested in understanding the basic, intuitive thinking behind the Read More...

04/14/2025 - Gene set analysis (GSA) is essential in genomic research, yet traditional methods often lack transparency and produce contextually irrelevant results, making interpretation challenging. While large language models (LLMs) offer a promising solution for result Read More...

04/07/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

03/17/2025 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering a several trainings that cover general concepts behind statistics and epidemiology. These trainings will help Read More...

03/10/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

03/03/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

02/24/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

02/10/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

02/03/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

01/27/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

01/13/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

01/08/2025 - This three hour online training will focus on getting started on using QIAGEN’s  Ingenuity Pathway Analysis (IPA) . IPA enables you to quickly identify biological relationships, mechanisms, pathways, functions and Read More...

01/06/2025 - AI Club is a weekly meeting that explores various topics relating to AI and deep learning in biomedical sciences, typically in a seminar, workshop, or journal club format. AI Club is intended to be Read More...

12/17/2024 - In this one-hour session we will describe resources available to NIH researchers for performing bioinformatics data analysis. These include trainings by specific groups or institutes (NCI, NIH Library, ODSS), licenses available for online learning ( Read More...

12/12/2024 - This class will introduce bulk RNA sequencing analysis using Qiagen software. Participants will learn how to process FASTQ files and obtain differential expression using CLC Genomics Workbench as well as extract biological insight using Read More...

12/09/2024 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering classes geared to cover general concepts behind statistics and epidemiology. This four-part lecture series will Read More...

12/05/2024 - This one and a half hour online training will provide a demonstration of how to identify cell types based on statistics, visualization, and canonical markers. One Peripheral blood mononuclear cells (PBMCs) sample will be Read More...

12/03/2024 - This one and a half hour online training  will provide a demonstration of how to build a Bulk RNA-Seq data analysis pipeline using a fastq file. Partek  Flow   Read More...

12/03/2024 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering classes geared to cover general concepts behind statistics and epidemiology. This four-part lecture series will Read More...

11/19/2024 - This one hour and a half online training in the NIH Library Evidence Synthesis Review series provides an overview of the data collection process for your review. The training will cover how to clean Read More...

11/15/2024 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering classes geared to cover general concepts behind statistics and epidemiology. This four-part lecture series will Read More...

11/08/2024 - In partnership with the NIH Clinical Center's Biostatistics and Clinical Epidemiology Service (BCES), the NIH Library is offering classes geared to cover general concepts behind statistics and epidemiology. This four-part lecture series will Read More...

09/23/2024 - Come to the Fair!  In the morning session, several different groups will speak about their training and education programs. The afternoon session will be devoted to learning about research using AI across Read More...

09/19/2024 - Qiagen Ingenuity Pathway Analysis (IPA) is a point-and-click software that enables scientists to discern how genomic, transcriptomic, proteomic, and metabolomic changes influence molecular biology pathways and networks. This software is available to NCI investigators, Read More...

08/15/2024 - Qiagen’s CLC Genomics Workbench is a point-and-click software for analyzing multi-omics sequencing data including variant analysis, RNA sequencing, and ChIP sequencing. This class will demonstrate variant analysis using this software. Participants will be Read More...

06/13/2024 - Qiagen CLC Genomics Workbench is a point-and-click bioinformatics software that runs on a personal computer and enables bulk RNA sequencing, ChIP sequencing, long reads, and variant analysis. NCI scientists can use CLC Genomics Workbench Read More...

06/11/2024 - Large language models (LLMs) are artificial intelligence (AI) algorithms that employ deep learning and extensive data sets to create new content. LLMs offer many possible applications in the biomedical field, such as the development Read More...

06/06/2024 - The CCR Genomics Core Facility is pleased to host a virtual technology workshop with EpiCypher on CUT&RUN library prep/sequencing Presentation overview: The location of histone post-translational modifications and chromatin-associated proteins Read More...

05/13/2024 - This in-person workshop will focus on data wrangling using tidy data principles. Tidy data describes a standard way of storing data that facilitates analysis and visualization within the  tidyverse  ecosystem. There will be a Read More...

05/09/2024 - This is the first class in the NIH Library Introduction to R Series. This class provides a basic overview of the functionality of R programming language and RStudio. R is Read More...

04/23/2024 - What’s the difference between “regular” statistics (i.e., what you may have been using in the past several years) and the “new” Bayesian Read More...

03/19/2024 - This class is designed for those who want to extend the basics covered in the Introduction to Quarto for Scholarly Publishing to Formatting class. This class uses Quarto to render formatted citations and bibliographies Read More...

03/06/2024 - Please join us on Wednesday, March 6 when Daniella Lowenberg from the University of California, California Digital Library will present “Defining the Need for Open Data Metrics.”   Widespread adoption Read More...

03/04/2024 - This class is designed for those who want to extend the basics of R Markdown and apply those skills in Quarto. Quarto is an open-source scientific and technical publishing system that offers multilingual programming Read More...

::: {.cell} library ( tidyverse ) ::: Remember that this loads the core tidyverse packages. There are other packages that you may be interested in; see here .

No summary available.

CREx News & Updates July 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Click below to learn how easy it is to navigate the CREx platform. These short videos will Read More...

CREx News & Updates August 2021 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Collaborative Research Exchange (CREx) News Site Spotlight FACILITY HIGHLIGHTS Learn more about services from the NHLBI Read More...

The CCR Genomics Core is located in Building 41 on the NIH Bethesda campus. The primary goal of the Core is to provide investigators from CCR/NCI and other NIH Institutes access to genomic technologies and Read More...

CREx News & Updates October 2021 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Collaborative Research Exchange (CREx) News Site Spotlight FACILITY HIGLIGHTS Learn more about services from the CPTR Read More...

CREx News & Updates November 2021 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Site Spotlight FACILITY HIGLIGHTS Learn more about services from the NINDS Quantitative Magnetic Resonance Imaging Core. NINDS Read More...

The FNLCR Molecular Histopathology Laboratory (MHL) provides comprehensive veterinary pathology support for animal health monitoring, biomarker discovery and validation, drug development, genomics, and proteomics on a cost recovered basis. The MHL is organized into multiple Read More...

The CCR Building 41 Flow Cytometry Core is a full-service facility within the Center for Cancer Research that supports over 150 users representing 26 laboratories. The Core Facility provides instrument and software training, technical expertise, assay development, and Read More...

Electron Microscopy Laboratory (EML) The EML offers investigators access to unique expertise and EM technologies that allow our partners to explore new avenues of research to enhance the knowledge of biological systems. To assist our Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Intramural CryoEM (NICE) Consortium NICE provides NCI, NIAID, NIEHS, NICHD, NIDCR, NEI, and NIA investigators with Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Extramural Common Fund Resources Metabolomics Workbench Developed by the NIH Metabolomics Common Fund's National Metabolomics Data Repository ( Read More...

The Flow Cytometry Core (LGI) offers established technologies to support studies using flow cytometry and cell sorting. Established Technologies Applications that run on FACS Caliburs include: Immunophenotyping (up to 4-color), Intracellular markers, including cytokines and Read More...

The EML offers investigators access to unique expertise and EM technologies that allow CCR Investigators to explore new avenues of research in order to enhance the knowledge of biological systems. To assist our customers, we Read More...

DTP’s Natural Products Repository is the world’s largest storehouse of natural products. It houses close to >200,000 extracts from samples of more than 70,000 plants and >20,000 marine organisms collected from more than 29 countries, plus extracts Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Technology Event Biophysical Methods for Protein Interactions Monday, May 15 – Friday, May 19, 2023 This workshop will review the strategies of Read More...

CREx Monthly Newsletter Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More NIH Cores on CREx NIBIB BEPS Micro Analytical Immunochemistry Unit The Micro Analytical Immunochemistry Unit employs a variety Read More...

The NIH Clinical Center Pharmacy Department provides pharmaceutical care to inpatients and outpatients on NIH intramural research protocols at the NIH Clinical Center. The Clinical Center facility encompasses 200 inpatient beds, 93 day-hospital stations, and 15 clinics. Clinical Read More...

Our operational objectives are to provide state-of-the-art OMICS technologies in support of the Genetics Branch (GB) investigators and collaborators. Research Services Wet Lab Single cell isolation from fresh, frozen, and FFPE tissue, DNA/RNA extractions Read More...

The Pan-Microbial Serology Facility (PMSF) is part of the Center for Cancer Research (CCR) at the National Cancer Institute (NCI). The PMSF focuses on determining individualized pan-microbial immune profiles associated with human diseases including immunological Read More...

Back Services: Biophysics Facility offers MST as an open-access instrument.  First-time users must complete a short training session before gaining access to the instrument reservation calendar.  Training includes the KD determination of a Read More...

NIH Intramural CryoEM Consortium (NICE) serves intramural investigators in all NIH IC’s. NICE provides access to state-of-the-art Titan Krios cryo-electron microscopes for atomic-resolution structure determination of protein, macromolecular complexes, membrane receptors, cellular organelles, and Read More...

The mission of Human Brain Collection Core (HBCC) within the National Institute of Mental Health, Division of Intramural Programs (NIMH IRP) is to conduct and support research on brain and behavior, with the goal of Read More...

The Staff Scientists/Clinicians (SSSC) Technical Enrichment Program (STEP) was established to provide SSSC’s an opportunity to compete for funding to gain comprehensive training in state-of-the-art techniques available through CCR Cores and Facilities. The Read More...

Molecular Cytogenetics Core Facility facilitates the assessment of structural and numerical genomic changes in pre-cancer and cancer research models. This core provides comprehensive support for the cytogenetic analysis of cells from human and research animal Read More...

The centrally funded Statistics team within the Advanced Biomedical Computational Science group at the Frederick National Lab provides statistical consultation and data analysis support for NCI laboratories. We have broad-range expertise in biomedically relevant areas Read More...

CREx News & Updates January 2022 Learn about the NIH Collaborative Research Exchange (CREx), Core Facilities, Webinars, & More Site Spotlight NCI ANTIBODY CHARACTERIZATION LABORATORY (ACL) The ACL specializes in rigorously validating antibodies for signaling and Read More...

[tabby title="Home"] About NICE-NIH Intramural CryoEM Consortium  NIH Intramural CryoEM Consortium (NICE) serves intramural investigators in all NIH IC’s. NICE provides access to state-of-the-art Titan Krios cryo-electron microscopes for atomic-resolution structure determination of Read More...

Back Services: Biophysics Facility offers MP as an open-access instrument.  First-time users must complete a short training session before gaining access to the instrument training calendar.  Training includes mass distribution analysis of a Read More...

The Trans-NIH Metabolomics Core (TNMC) is a shared research resource that performs metabolomics analysis (and related small molecule research) for investigators at all Institutes and Centers across the NIH Intramural Research Program. The TNMC is Read More...

The Biomedical Engineering and Physical Science (BEPS) shared resource supports NIH’s intramural basic and clinical scientists on applications of engineering, physics, imaging, measurement, and analysis. BEPS is centrally located on the main NIH campus Read More...

The facilities at AIM are available for use by the entire NIH intramural research community. While we welcome users with any size imaging project, AIM specializes in large, yearlong (or longer), collaborative research efforts with Read More...

Back Services: Biophysics Facility offers DLS as an open-access instrument. First-time users must complete a short training session before gaining access to the instrument reservation calendar. Training includes DLS analysis of small- and large-molecular size Read More...

Back Services: We offer a limited sample processing service using standard SEC-MALS and FFF protocols.  This service is intended for the occasional users of this system.  Researchers who expect to use this instrument Read More...

Back Services: We offer a limited sample processing service using standard SEC-MALS and FFF protocols.  This service is intended for the occasional users of this system.  Researchers who expect to use this instrument Read More...

The Chemistry and Synthesis Center (CSC) of the National Heart, Lung, and Blood Institute (NHLBI) provides IRP scientists with targeted imaging probes and chemical tools that help accelerate cell-based assays, in vivo imaging studies, and Read More...

In order to meet increasing demands from both NIH intramural and extramural communities for access to a small angle X-ray scattering (SAXS) resource, the Center for Cancer Research (CCR) under the leadership of Drs. Jeffrey Read More...

Lesson 10: Introducing the FASTQ file and assessing sequencing data quality Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 9 Review In the previous lesson, we explored the reference genomes and Read More...

Lesson 11: Merging FASTQ quality reports and data cleanup Before getting started, remember to be signed on to the DNAnexus GOLD environment. Lesson 10 Review In the previous lesson, we learned about the structure of the FASTQ Read More...

This archive contains past and present issues of the  BTEP BioInformatics Bulletin. The BTEP Bioinformatics Bulletin features select upcoming bioinformatics events offered across NIH and is distributed monthly via email to the Center Read More...

The computational chemistry and protein modeling team in the Advanced Biomedical Computational Science (ABCS) group provides novel solutions in structural modeling and computational chemistry. Computational scientists in the group collaborate with NCI researchers by using Read More...

BTEP strives to maintain links to resources that should be of interest to CCR Bioinformatics Community.  Some of the resources to will be accessible through more than one of these lists, but since the lists Read More...

Listed below are the video recordings of past BTEP events (classes, seminars, workshops). Videos are hosted on various servers and may play slightly differently. Some videos may be downloaded for local viewing. Recorded Videos of Read More...

11/19/2024 - Partek Flow enables scientists to construct analysis workflows for multi-omics sequencing data including DNA, bulk and single cell RNA, spatial transcriptomics, ATAC and ChIP. It is a point-and-click software hosted on Biowulf, the NIH Read More...

11/13/2024 - The National Library of Medicine (NLM) Division of Intramural Research (DIR) is pleased to welcome Manisha Desai, PhD, Section Chief of Biostatistics and Director of the Quantitative Sciences Unit at Stanford University School of Read More...

08/08/2024 - What are common statistical analyses for binary data? What is the distribution of your binary dependent variable? What is the difference from normally distributed data? How do you model the binary outcome with multiple Read More...

Clinicians and bench scientists (a.k.a., wet lab researchers) are at the forefront of scientific achievement. However, most, if not all contemporary projects involve robust scientific analysis, where the tools of exploration aren’t Read More...

07/18/2024 - Long read sequencing holds an advantage over short read sequencing in areas such as structural variant and transcript isoform discovery.  This class will demonstrate long read analysis using Qiagen’s CLC Genomics Workbench, a Read More...

Partek Flow enables scientists to build comprehensive workflows for analyzing multi-omics high throughput sequencing data including DNA and variant calling, bulk and single cell modalities for RNA, ChIP, and ATAC, spatial transcriptomics, CITE, and immune Read More...

06/20/2024 - What are common statistical analyses for continuous data? Can you check whether your continuous outcome is normally distributed? What are the methods when the data are not normal? How do you model the outcome Read More...

Now, that we have clusters, we can use differential expression analysis to uncover markers that define our clusters. These markers can be used to assign cell types to our clusters. First, because we are working Read More...

Learning Objectives This tutorial was designed to demonstrate common secondary analysis steps in a scRNA-Seq workflow. We will start with a merged Seurat Object with multiple data layers representing multiple samples. Throughout this tutorial we Read More...

1. Introduction and Learning Objectives This tutorial has been designed to demonstrate common secondary analysis steps in a scRNA-Seq workflow. We will start with a merged Seurat Object with multiple data layers representing multiple samples that Read More...

This lesson provides an introduction to R in the context of single cell RNA-Seq analysis with Seurat. Learning Objectives Learn about options for analyzing your scRNA-Seq data. Learn about resources for learning R programming. Learn Read More...

05/16/2024 - Qiagen CLC Genomics Workbench is a point-and-click bioinformatics software that runs on a personal computer and enables bulk RNA sequencing, ChIP sequencing, long reads, and variant analysis. NCI scientists can use CLC Genomics Workbench Read More...

04/01/2024 - Embark on a journey of visionary insights! Join us for the launch of the NEI Informatics & Data-Driven Insights: Seminars & Dialogue Opportunities for Vision Health series, hosted by the National Eye Read More...

No summary available.

No summary available.